SPAtyping¶
The spa typing method is based on sequencing of the polymorphic X region of the protein A gene (spa), present in all strains of Staphylococcus aureus. The X region is constituted of a variable number of 24-bp repeats (exceptions of 21 to 30 exist) flanked by well-conserved regions. Due to its repeat structure, the spa locus simultaneously indexes micro- and macrovariations, enabling the use of spa typing in both local and global epidemiological studies [4].
Establishment of standardized spa type nomenclature and Internet shared databases is crucial for the success of this typing method. The most important and reference database for this purpose is the SeqNet/Ridom Spa Server.
Each new base composition of the polymorphic repeat found in a strain is assigned a unique repeat code. The order of specific repeats for a given strain determines its spa type.
Original source: Applied Maths Bionumerics website. First, a repeat classification is generated. Then, based on the specific repeat order the spa type is determined.¶
BacterialTyper relies on a python module named spaTyper (https://github.com/JFsanchezherrero/spa_typing,
https://pypi.org/project/spaTyper/) (developed in collaboration with Mitchell Sullivan). This module automatically
synchronizes repeats and spa type signatures with the SeqNet/Ridom Spa Server and identifies spa protein in a given assembly.
It automatically retrieves repeats from: http://spa.ridom.de/dynamic/sparepeats.fasta and spa types from http://spa.ridom.de/dynamic/spatypes.txt
Here we show an example of SPA repeats:
>r01
GAGGAAGACAACAACAAGCCTAGC
>r02
AAAGAAGACAACAAAAAACCTGGC
>r03
GAGGAAGACAATAACAAACCTGGT
>r04
GAGGAAGACAATAACAAGCCTGGT
>r05
AAAGAAGACAACAAAAAGCCTGGC
...
And an example of SPA typing:
Spa Type |
Spa Repeat combination |
|---|---|
t1676 |
15-12-16-02-16-02-25-17-24-24-24-17 |
t1677 |
11-19-12-12-17-34-24-34-22-25 |
t1678 |
11-19-12-21-17-34-24-02-22-25 |
t1679 |
26-23-66-34-17-20-17-12-17-16 |
t1636 |
14-44-13-12-17-17-17-17-17-17-23-18 |
t1637 |
14-44-13-12-18 |
t1638 |
14-54-44-13-12-17-17-17-17-23-18 |
t1696 |
124-22-34-17-20-17-12-17-16 |
t1639 |
07-16-34-12-12-23-02-12-23 |